About   Help   FAQ
Uqcr10em1(IMPC)Bay
Endonuclease-mediated Allele Detail
Summary
Symbol: Uqcr10em1(IMPC)Bay
Name: ubiquinol-cytochrome c reductase, complex III subunit X; endonuclease-mediated mutation 1, Baylor College of Medicine
MGI ID: MGI:6257426
Synonyms: Uqcr10-
Gene: Uqcr10  Location: Chr11:4651973-4654342 bp, - strand  Genetic Position: Chr11, 2.96 cM
Alliance: Uqcr10em1(IMPC)Bay page
IMPC: Uqcr10 gene page
Uqcr10em1(IMPC)Bay/Uqcr10em1(IMPC)Bay mice exhibit embryonic lethality, with embryos recovered at E7.5 but not at E9.5. Embryos show severe developmental delay presenting as a small egg cylinder and poorly organized extraembryonic tissues.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6N
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready, Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at Bayor College of Medicine by injecting CAS9 RNA, 2 guide sequences GCACGGTCTCAACTACCAAGCGG, CCGAACTCGCGCCACTGCGCTTG, and a donor oligo, which resulted in a Conditional Ready allele. (J:265051)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Uqcr10 Mutation:  17 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory