About   Help   FAQ
Fblim1em5(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Fblim1em5(IMPC)Tcp
Name: filamin binding LIM protein 1; endonuclease-mediated mutation 5, The Centre for Phenogenomics
MGI ID: MGI:6257420
Gene: Fblim1  Location: Chr4:141303373-141333351 bp, - strand  Genetic Position: Chr4, 74.64 cM, cytoband E1
Alliance: Fblim1em5(IMPC)Tcp page
IMPC: Fblim1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele produced from project TCPR0328 at TCP by injecting Cas9 mRNA and one guide RNA with the spacer sequence CTTGTGAAGCCAGACGCGCT and a single-strand oligonucleotide encoding a point mutation. This allele resulted from non-homologous end-joining repair and a 2-bp deletion from Chr4:141595338 to 141595339 in exon OTTMUSE00000117321. This mutation is predicted to cause a frameshift with amino acid changes after residue 40 and early truncation 51 amino acids later (p.A40Sfs*53). (GRCm38). (J:265051)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Fblim1 Mutation:  82 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory