Ndc80^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ndc80^em1(IMPC)J
• Name: NDC80 kinetochore complex component; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6256533
• Synonyms: Ndc80^-
• Gene: Ndc80 Location: Chr17:71803095-71833852 bp, - strand Genetic Position: Chr17, 41.87 cM, cytoband E2
• Alliance: Ndc80^em1(IMPC)J page
• IMPC: Ndc80 gene page

Ndc80^em1(IMPC)J/Ndc80^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as early blastocysts but not at E7.5. Blastocysts fail to hatch from the zona pellucida and are dead after 72 hours in culture.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences ACTTATATTAGCAAAGTTTC and TCATGTGCAAAGCTTCCGAG that targeted exon(s) ENSMUSE00000137722.4. This resulted in deletion(s) of 364 bp (location: Chr17:71825719-71826082; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ndc80 Mutation: 38 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 5 reference(s)