Ndc80em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Ndc80em1(IMPC)J |
| Name: |
NDC80 kinetochore complex component; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6256533 |
| Synonyms: |
Ndc80- |
| Gene: |
Ndc80 Location: Chr17:71803095-71833852 bp, - strand Genetic Position: Chr17, 41.87 cM, cytoband E2
|
| Alliance: |
Ndc80em1(IMPC)J page
|
| IMPC: |
Ndc80 gene page |
|
Ndc80em1(IMPC)J/Ndc80em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as early blastocysts but not at E7.5. Blastocysts fail to hatch from the zona pellucida and are dead after 72 hours in culture.
Show the 1 phenotype image(s) involving this allele.
|
|
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATAGGTAAGATAAGAACCAT and GTATAAGAGTATTTAAGGAG, which resulted in a 364 bp deletion beginning at Chromosome 17 position 71,518,724 bp and ending after 71,519,087 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000137722 (exon 6) and 261 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 159 and early truncation 4 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
4 reference(s) |
|