Naip2em2Vnce
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Naip2em2Vnce |
| Name: |
NLR family, apoptosis inhibitory protein 2; endonuclease-mediated mutation 2, Russell E Vance |
| MGI ID: |
MGI:6246533 |
| Gene: |
Naip2 Location: Chr13:100280571-100338600 bp, - strand Genetic Position: Chr13, 53.01 cM, cytoband D1-D3
|
| Alliance: |
Naip2em2Vnce page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: A single guide RNA (sgRNA; sequence GGTCAGAAGAGAATTACCTA) with protospacer adjacent motif (PAM; sequence TGG) targeted Cas9 to a 20-nucleotide sequence in exon 6 (the fourth coding exon) in each of the four functional mouse Naip genes (Naip1, 2, 5, and 6), resulting in a 4 bp frameshift deletion in Naip2 gene. The deletion is predicted to result in NAIP proteins truncated before the NBD (a domain essential for NAIP). The sequence between Naip5 exon 6 and Naip1 exon 6 was deleted including Naip3 and Naip6, leading to a nonfunctional fusion of Naip5 and Naip1, generating separate allele deletion, Chr 13, Russell Vance 1.
(J:233320)
|
|
|
|
|
| Original: |
J:233320 Rauch I, et al., NAIP proteins are required for cytosolic detection of specific bacterial ligands in vivo. J Exp Med. 2016 May 2;213(5):657-65 |
| All: |
3 reference(s) |
|