About   Help   FAQ
Naip2em2Vnce
Endonuclease-mediated Allele Detail
Summary
Symbol: Naip2em2Vnce
Name: NLR family, apoptosis inhibitory protein 2; endonuclease-mediated mutation 2, Russell E Vance
MGI ID: MGI:6246533
Gene: Naip2  Location: Chr13:100280571-100338600 bp, - strand  Genetic Position: Chr13, 53.01 cM, cytoband D1-D3
Alliance: Naip2em2Vnce page
Mutation
origin
Strain of Origin:  B6(Cg)-Tyrc-2J/J
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsA single guide RNA (sgRNA; sequence GGTCAGAAGAGAATTACCTA) with protospacer adjacent motif (PAM; sequence TGG) targeted Cas9 to a 20-nucleotide sequence in exon 6 (the fourth coding exon) in each of the four functional mouse Naip genes (Naip1, 2, 5, and 6), resulting in a 4 bp frameshift deletion in Naip2 gene. The deletion is predicted to result in NAIP proteins truncated before the NBD (a domain essential for NAIP). The sequence between Naip5 exon 6 and Naip1 exon 6 was deleted including Naip3 and Naip6, leading to a nonfunctional fusion of Naip5 and Naip1, generating separate allele deletion, Chr 13, Russell Vance 1. (J:233320)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Naip2 Mutation:  120 strains or lines available
References
Original:  J:233320 Rauch I, et al., NAIP proteins are required for cytosolic detection of specific bacterial ligands in vivo. J Exp Med. 2016 May 2;213(5):657-65
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory