Naip2^em2Vnce
Endonuclease-mediated Allele Detail

Summary

• Symbol: Naip2^em2Vnce
• Name: NLR family, apoptosis inhibitory protein 2; endonuclease-mediated mutation 2, Russell E Vance
• MGI ID: MGI:6246533
• Gene: Naip2 Location: Chr13:100280571-100338600 bp, - strand Genetic Position: Chr13, 53.01 cM, cytoband D1-D3
• Alliance: Naip2^em2Vnce page

Mutation origin

• Strain of Origin: B6(Cg)-Tyr^c-2J/J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: A single guide RNA (sgRNA; sequence GGTCAGAAGAGAATTACCTA) with protospacer adjacent motif (PAM; sequence TGG) targeted Cas9 to a 20-nucleotide sequence in exon 6 (the fourth coding exon) in each of the four functional mouse Naip genes (Naip1, 2, 5, and 6), resulting in a 4 bp frameshift deletion in Naip2 gene. The deletion is predicted to result in NAIP proteins truncated before the NBD (a domain essential for NAIP). The sequence between Naip5 exon 6 and Naip1 exon 6 was deleted including Naip3 and Naip6, leading to a nonfunctional fusion of Naip5 and Naip1, generating separate allele deletion, Chr 13, Russell Vance 1. (J:233320)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Naip2 Mutation: 120 strains or lines available

References

• Original: J:233320 Rauch I, et al., NAIP proteins are required for cytosolic detection of specific bacterial ligands in vivo. J Exp Med. 2016 May 2;213(5):657-65
• All: 3 reference(s)