Naip1^em1Vnce
Endonuclease-mediated Allele Detail

Summary

• Symbol: Naip1^em1Vnce
• Name: NLR family, apoptosis inhibitory protein 1; endonuclease-mediated mutation 1, Russell E Vance
• MGI ID: MGI:6246498
• Synonyms: Naip1^-
• Gene: Naip1 Location: Chr13:100544272-100589372 bp, - strand Genetic Position: Chr13, 53.18 cM, cytoband D1-D3
• Alliance: Naip1^em1Vnce page

Mutation origin

• Strain of Origin: B6(Cg)-Tyr^c-2J/J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Single guide RNA (sgRNA; sequence GGTCAGAAGAGAATTACCTA) with protospacer adjacent motif (PAM; sequence TGG) targeted Cas9 to a 23-nucleotide sequence in exon 6 (the fourth coding exon) of the gene resulting in a 23 bp frameshift deletion. The deletion is predicted to result in proteins truncated before the NBD (a domain essential for NAIP). (J:233320)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Naip1 Mutation: 78 strains or lines available

References

• Original: J:233320 Rauch I, et al., NAIP proteins are required for cytosolic detection of specific bacterial ligands in vivo. J Exp Med. 2016 May 2;213(5):657-65
• All: 1 reference(s)