About   Help   FAQ
Dnajb4em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Dnajb4em1(IMPC)J
Name: DnaJ heat shock protein family (Hsp40) member B4; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6241427
Gene: Dnajb4  Location: Chr3:151887217-151915720 bp, - strand  Genetic Position: Chr3, 77.03 cM
Alliance: Dnajb4em1(IMPC)J page
IMPC: Dnajb4 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTTCCTAGAGAGTTACCATG and GCTAAAACGTTAACATAGGA, which resulted in an 837 bp deletion beginning at Chromosome 3 position 152,186,292 bp and ending after 152,187,134 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000175378(exon 5) and 274 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 71 and early truncation 6 amino acids later. Also, after the deletion of 381 bp of sequence there is a 6 bp [GGTCTT] endogenous retention followed by an additional 405 deleted bp. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Dnajb4 Mutation:  20 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory