Insyn2aem1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Insyn2aem1(IMPC)J |
| Name: |
inhibitory synaptic factor 2A; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6241425 |
| Gene: |
Insyn2a Location: Chr7:134483655-134540159 bp, - strand Genetic Position: Chr7, 80.86 cM
|
| Alliance: |
Insyn2aem1(IMPC)J page
|
| IMPC: |
Insyn2a gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCAGGGCTGCAGTCTGACAA and GATTTGGCTGGACGTCCATT, which resulted in a 1383 bp deletion beginning at Chromosome 7 position 134,917,508 bp and ending after 134,918,890 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000632020 (exon 2) and 221 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a null allele by removing the start of translation.
(J:188991, J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|