About   Help   FAQ
Mon1bem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Mon1bem1(IMPC)J
Name: MON1 homolog B, secretory traffciking associated; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6241417
Gene: Mon1b  Location: Chr8:114362219-114371811 bp, + strand  Genetic Position: Chr8, 59.65 cM
Alliance: Mon1bem1(IMPC)J page
IMPC: Mon1b gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTAACTTAGACACAGCACG and TTAGACTTGAGGGTATCTCG, which resulted in a 1279 bp deletion beginning at Chromosome 8 position 113,638,301 bp and ending after 113,639,579 bp bp (GRCm38/mm10). This mutation deletes ENSMUSE00000305362 (exon 3) and 454 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 164 and early truncation 3 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Mon1b Mutation:  18 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory