About   Help   FAQ
Akap8lem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Akap8lem1(IMPC)J
Name: A kinase anchor protein 8-like; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6231175
Gene: Akap8l  Location: Chr17:32540398-32569581 bp, - strand  Genetic Position: Chr17, 17.5 cM, cytoband B2
Alliance: Akap8lem1(IMPC)J page
IMPC: Akap8l gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCTCTGCCTAGGAAAAACGG and TGGAGTCAAGAGACTCCAAA, which resulted in a 964 bp deletion beginning at Chromosome 17 position 32,335,377 bp and ending after 32,336,340 bp (GRCm38/mm10). This mutation deletes the last 56 bp of ENSMUSE00000137572 (exon 5), all of ENSMUSE00000137565, ENSMUSE00000137575, and ENSMUSE00000137582 (exons 6, 7, 8), and 679 bp of flanking intronic sequence including the splice acceptors and donors. This is predicted to cause a change of amino acid sequence after residue 254 and early truncation 11 amino acids later due to read through into the intron between exons 8 and 9. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Akap8l Mutation:  57 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory