About   Help   FAQ
Cd4em2Litt
Endonuclease-mediated Allele Detail
Summary
Symbol: Cd4em2Litt
Name: CD4 antigen; endonuclease-mediated mutation 2, Dan R Littman
MGI ID: MGI:6220678
Synonyms: Cd4E4mdelta, Rr95em2Litt
Gene: Cd4  Location: Chr6:124841655-124865184 bp, - strand  Genetic Position: Chr6, 59.17 cM
Alliance: Cd4em2Litt page
Mutation
origin
Strain of Origin:  Not Specified
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intragenic deletion
 
Mutation detailsUsing (Rr94tm3.2Litt) embryos, CRISPR/cas9 technology was used with gRNAs (targeting AAGCCAGGCTACTTGTTTAC and AGCCAATTCCCAGCGTGCGT), resulting in the deletion of the "maturity" enhancer E4m, a novel cis regulatory element in intron 1 of the Cd4 gene (chr6:124861957-124862580 (GRCm39)). (J:101977)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Cd4 Mutation:  85 strains or lines available
Notes
Cas9 and guide RNAs were co-injected into embryos derived from Cd4tm3.2Litt mice on a C57BL/6J, 129, and FVB mixed genetic background.
References
Original:  J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory