Cd4^em2Litt
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cd4^em2Litt
• Name: CD4 antigen; endonuclease-mediated mutation 2, Dan R Littman
• MGI ID: MGI:6220678
• Synonyms: Cd4^E4mdelta, Rr95^em2Litt
• Gene: Cd4 Location: Chr6:124841655-124865184 bp, - strand Genetic Position: Chr6, 59.17 cM
• Alliance: Cd4^em2Litt page

Mutation origin

• Strain of Origin: Not Specified

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intragenic deletion
• Mutation details: Using (Rr94^tm3.2Litt) embryos, CRISPR/cas9 technology was used with gRNAs (targeting AAGCCAGGCTACTTGTTTAC and AGCCAATTCCCAGCGTGCGT), resulting in the deletion of the "maturity" enhancer E4m, a novel cis regulatory element in intron 1 of the Cd4 gene (chr6:124861957-124862580 (GRCm39)). (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Cd4 Mutation: 84 strains or lines available

Notes

Cas9 and guide RNAs were co-injected into embryos derived from Cd4^tm3.2Litt mice on a C57BL/6J, 129, and FVB mixed genetic background.

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 1 reference(s)