About   Help   FAQ
Cmya5em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Cmya5em1(IMPC)J
Name: cardiomyopathy associated 5; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6209671
Gene: Cmya5  Location: Chr13:93177221-93281232 bp, - strand  Genetic Position: Chr13, 47.81 cM, cytoband C3
Alliance: Cmya5em1(IMPC)J page
IMPC: Cmya5 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CGAGGTTTCAGCACTCGACA and GTTATCAGATGAGGATGAGG, which resulted in a 9281 bp deletion beginning at Chromosome 13 position 93,089,133 bp and ending after 93,098,413 bp (GRCm38/mm10). This mutation deletes 9281 bp from ENSMUSE00000356892 (exon 2) and is predicted to cause a change of amino acid sequence after residue 55 and early truncation 3 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Cmya5 Mutation:  148 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  5 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory