About   Help   FAQ
Nup205em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Nup205em1(IMPC)J
Name: nucleoporin 205; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6209645
Synonyms: Nup205-
Gene: Nup205  Location: Chr6:35154551-35224534 bp, + strand  Genetic Position: Chr6, 15.24 cM, cytoband B1
Alliance: Nup205em1(IMPC)J page
IMPC: Nup205 gene page
Nup205em1(IMPC)J/Nup205em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts fail to hatch from the zona pellucida and are dead after 72hr in vitro.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by Microinjection Cas9 mRNA and 2 guide sequences AGGGGATATGAGGCAACACG and TGAAGCTAGAACCCCTATCT, which resulted in a 605 bp deletion beginning at Chromosome 6 position 35,186,016 bp and ending after 35,186,665 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000469332 (exon 3) and 478 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 57 and early truncation 15 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Nup205 Mutation:  101 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory