Krt40em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Krt40em1(IMPC)J |
Name: |
keratin 40; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6208874 |
Gene: |
Krt40 Location: Chr11:99428311-99433984 bp, - strand Genetic Position: Chr11, 62.92 cM
|
Alliance: |
Krt40em1(IMPC)J page
|
IMPC: |
Krt40 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences GTTTCCTCAAGGCCTGACTA, TCCATAACTGTAGCTCCGTG, AGTGAAAGAAAGGCGTGGCC and AAGTTCAGATTCTCTTGGTT, which resulted in a 2013 bp deletion beginning at Chromosome 11 position 99,538,431 bp and ending after 99,540,443 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000503157, ENSMUSE00001061939, ENSMUSE00000577306 (exons 4-6) and 1504 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 229 and early truncation 16 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
1 reference(s) |
|