Krt40^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Krt40^em1(IMPC)J
• Name: keratin 40; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6208874
• Gene: Krt40 Location: Chr11:99428311-99433984 bp, - strand Genetic Position: Chr11, 62.92 cM
• Alliance: Krt40^em1(IMPC)J page
• IMPC: Krt40 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences GTTTCCTCAAGGCCTGACTA, TCCATAACTGTAGCTCCGTG, AGTGAAAGAAAGGCGTGGCC and AAGTTCAGATTCTCTTGGTT, which resulted in a 2013 bp deletion beginning at Chromosome 11 position 99,538,431 bp and ending after 99,540,443 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000503157, ENSMUSE00001061939, ENSMUSE00000577306 (exons 4-6) and 1504 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 229 and early truncation 16 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Krt40 Mutation: 26 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)