About   Help   FAQ
Avpr1aem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Avpr1aem1(IMPC)J
Name: arginine vasopressin receptor 1A; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6208800
Gene: Avpr1a  Location: Chr10:122284404-122289357 bp, + strand  Genetic Position: Chr10, 70.36 cM, cytoband D3
Alliance: Avpr1aem1(IMPC)J page
IMPC: Avpr1a gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGGAGGCTGGAGAAATTCCG and TAGAAGCTTAACTATTGAAT, which resulted in a 1550 bp deletion beginning at Chromosome 10 position 122,448,382 bp and ending after 122,449,931 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000100823 (exon 1) and 259 bp of flanking intronic sequence including the start of translation and splice donor and is predicted to result in a null allele. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Avpr1a Mutation:  40 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory