About   Help   FAQ
Trex1em1Aiwsk
Endonuclease-mediated Allele Detail
Summary
Symbol: Trex1em1Aiwsk
Name: three prime repair exonuclease 1; endonuclease-mediated mutation 1, Akiko Iwasaki
MGI ID: MGI:6201209
Gene: Trex1  Location: Chr9:108887000-108888791 bp, - strand  Genetic Position: Chr9, 59.63 cM
Alliance: Trex1em1Aiwsk page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsCRISPR/Cas9 is used to remove the single coding exon of the gene. Two single guide RNAs (sgRNAs) were employed: CTGTTAATTAGCCTAACAGG in the region upstream of the coding exon, and TCAGGGTAATTCCCGAAGAG in the downstream region. The intervening sequence was excised. (J:101977)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Trex1 Mutation:  29 strains or lines available
References
Original:  J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory