Lrfn1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Lrfn1^em1(IMPC)J
• Name: leucine rich repeat and fibronectin type III domain containing 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6200431
• Gene: Lrfn1 Location: Chr7:28151405-28167667 bp, + strand Genetic Position: Chr7, 16.77 cM, cytoband A3
• Alliance: Lrfn1^em1(IMPC)J page
• IMPC: Lrfn1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGCCCGGAGGAGAAGGGGCC and CAGATGACTCCCTAGTCTAC, which resulted in a 1398 bp deletion beginning at Chromosome 7 position 28,458,664 bp and ending after 28,460,061 bp (GRCm38/mm10). This mutation deletes 1398 bp of ENSMUSE00000365917 (exon 1) and is predicted to cause a change of amino acid sequence and early truncation after residue 4. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Lrfn1 Mutation: 22 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)