About   Help   FAQ
Lrfn1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Lrfn1em1(IMPC)J
Name: leucine rich repeat and fibronectin type III domain containing 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6200431
Gene: Lrfn1  Location: Chr7:28151405-28167667 bp, + strand  Genetic Position: Chr7, 16.77 cM, cytoband A3
Alliance: Lrfn1em1(IMPC)J page
IMPC: Lrfn1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGCCCGGAGGAGAAGGGGCC and CAGATGACTCCCTAGTCTAC, which resulted in a 1398 bp deletion beginning at Chromosome 7 position 28,458,664 bp and ending after 28,460,061 bp (GRCm38/mm10). This mutation deletes 1398 bp of ENSMUSE00000365917 (exon 1) and is predicted to cause a change of amino acid sequence and early truncation after residue 4. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Lrfn1 Mutation:  22 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory