About   Help   FAQ
Tspyl1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tspyl1em1(IMPC)J
Name: testis-specific protein, Y-encoded-like 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6200424
Gene: Tspyl1  Location: Chr10:34158186-34160881 bp, + strand  Genetic Position: Chr10, 18.85 cM
Alliance: Tspyl1em1(IMPC)J page
IMPC: Tspyl1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGGTCCCCTCGTCCCGCTCC and GCTCCCTTATTGGGCGACGT, which resulted in a 1076 bp deletion beginning at Chromosome 10 position 34,282,295 bp and ending after 34,283,370 bp (GRCm38/mm10). This mutation deletes 1076 bp of ENSMUSE00000350290 (exon 1) and is predicted to cause a change of amino acid sequence after residue 4 and truncation 57 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Tspyl1 Mutation:  13 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory