About   Help   FAQ
Kctd11em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Kctd11em1(IMPC)J
Name: potassium channel tetramerisation domain containing 11; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6200410
Gene: Kctd11  Location: Chr11:69769090-69771811 bp, - strand  Genetic Position: Chr11, 42.91 cM
Alliance: Kctd11em1(IMPC)J page
IMPC: Kctd11 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGCGCTTTGTGCGCCACTGA and CCATGCTGGGGGCCATGTTT, which resulted in a 697 bp deletion beginning at Chromosome 11 position 69,879,502 bp and ending after 69,880,198 bp (GRCm38/mm10). This mutation deletes 697 bp of ENSMUSE00000354980 (exon 1) and is predicted to cause a change of amino acid sequence after residue 4 and truncation 103 amino acids later by read-through into the 3-prime UTR. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Kctd11 Mutation:  15 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/14/2026
MGI 6.24
The Jackson Laboratory