Kctd11^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Kctd11^em1(IMPC)J
• Name: potassium channel tetramerisation domain containing 11; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6200410
• Gene: Kctd11 Location: Chr11:69769090-69771811 bp, - strand Genetic Position: Chr11, 42.91 cM
• Alliance: Kctd11^em1(IMPC)J page
• IMPC: Kctd11 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGCGCTTTGTGCGCCACTGA and CCATGCTGGGGGCCATGTTT, which resulted in a 697 bp deletion beginning at Chromosome 11 position 69,879,502 bp and ending after 69,880,198 bp (GRCm38/mm10). This mutation deletes 697 bp of ENSMUSE00000354980 (exon 1) and is predicted to cause a change of amino acid sequence after residue 4 and truncation 103 amino acids later by read-through into the 3-prime UTR. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Kctd11 Mutation: 14 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)