About   Help   FAQ
Mxra8em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Mxra8em1(IMPC)J
Name: matrix-remodelling associated 8; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6200400
Gene: Mxra8  Location: Chr4:155924137-155928545 bp, + strand  Genetic Position: Chr4, 87.58 cM, cytoband E2
Alliance: Mxra8em1(IMPC)J page
IMPC: Mxra8 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGACTGCAGGAGGCCCCAAG and GGTGGTATACAATGGTGGGA, which resulted in a 3613 bp deletion beginning at Chromosome 4 position 155,840,716 bp and ending after 155,844,328 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000503248 through ENSMUSE00000228201 (exons 2 through 10) and 1575 bp of flanking intronic sequence including the splice acceptors and donors. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Mxra8 Mutation:  32 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory