About   Help   FAQ
Mrgprgem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Mrgprgem1(IMPC)J
Name: MAS-related GPR, member G; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6200361
Gene: Mrgprg  Location: Chr7:143317447-143320730 bp, - strand  Genetic Position: Chr7, 88.31 cM
Alliance: Mrgprgem1(IMPC)J page
IMPC: Mrgprg gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Mrgprg-115062J-8267M was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATAGCCCCCCAAGACCTGAC and TGTTCTCCATATTCAACATC, which resulted in an 819 bp deletion beginning at Chromosome 7 position 143,764,544 bp and ending after 143,765,362 bp (GRCm38/mm10). This mutation deletes 819 bp of ENSMUSE00000378852 (exon 2) and is predicted to cause a deletion of 273 amino acids after residue 4 and before residue 277. This would effectively remove all but 16 amino acids of the coding sequence. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Mrgprg Mutation:  13 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory