Tesk1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Tesk1em1(IMPC)J |
| Name: |
testis specific protein kinase 1; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6200319 |
| Gene: |
Tesk1 Location: Chr4:43442277-43448075 bp, + strand Genetic Position: Chr4, 23.04 cM, cytoband A5-C1
|
| Alliance: |
Tesk1em1(IMPC)J page
|
| IMPC: |
Tesk1 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TGTGTGCCCGACAGGTTGGG, ACGGGTGGAACGATTAAAGA, CCAGCAAGCTGTCCAGCAAG and GTAGATACGTTAGGATGTCG, which resulted in a 899 bp deletion beginning at Chromosome 4 position 43,443,924 bp and ending after 43,444,822 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000179378, ENSMUSE00000384697 (exons 3 and 4) and 703 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 109 and early truncation 154 amino acids later. In addition, there is a 5 bp deletion (CCAAC) 175 bp before the deletion and a single bp [C] insertion at the deletion site.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|