Rasgef1b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rasgef1b^em1(IMPC)J
• Name: RasGEF domain family, member 1B; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6200233
• Gene: Rasgef1b Location: Chr5:99365279-99400786 bp, - strand Genetic Position: Chr5, 48.46 cM
• Alliance: Rasgef1b^em1(IMPC)J page
• IMPC: Rasgef1b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAAACGTTCAGAATGCTTTA and GATAAGCCTGTGAATGCGCA, which resulted in a 501 bp deletion beginning at Chromosome 5 position 99,231,939 bp and ending after 99,232,439 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001389974, ENSMUSE00001391017 (exons 7 and 8) and 302 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 243 and early truncation 2 amino acids later. (J:188991, J:384794)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Rasgef1b Mutation: 41 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)