Tubb2b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tubb2b^em1(IMPC)J
• Name: tubulin, beta 2B class IIB; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6199642
• Gene: Tubb2b Location: Chr13:34310991-34314337 bp, - strand Genetic Position: Chr13, 14.04 cM, cytoband A4
• Alliance: Tubb2b^em1(IMPC)J page
• IMPC: Tubb2b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences ATTATCACTAGCACAAAGGG, GGGCTGCTCATTGAGATTGG, TTGAAATAGCCTTATCTGAG and ATCAGAAAGTTGAAACTGGG, which resulted in a 595 bp deletion beginning at Chromosome 13 position 34,128,808 bp and ending after 34,129,402 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001073370 and ENSMUSE00001093042(exons 2 and 3) and 375 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 19 and early truncation 27 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tubb2b Mutation: 21 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)