About   Help   FAQ
Tubb2bem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tubb2bem1(IMPC)J
Name: tubulin, beta 2B class IIB; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6199642
Gene: Tubb2b  Location: Chr13:34310991-34314337 bp, - strand  Genetic Position: Chr13, 14.04 cM, cytoband A4
Alliance: Tubb2bem1(IMPC)J page
IMPC: Tubb2b gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences ATTATCACTAGCACAAAGGG, GGGCTGCTCATTGAGATTGG, TTGAAATAGCCTTATCTGAG and ATCAGAAAGTTGAAACTGGG, which resulted in a 595 bp deletion beginning at Chromosome 13 position 34,128,808 bp and ending after 34,129,402 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001073370 and ENSMUSE00001093042(exons 2 and 3) and 375 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 19 and early truncation 27 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Tubb2b Mutation:  19 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory