About   Help   FAQ
Zfp438em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zfp438em1(IMPC)J
Name: zinc finger protein 438; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6198633
Gene: Zfp438  Location: Chr18:5210029-5334807 bp, - strand  Genetic Position: Chr18, 3.02 cM
Alliance: Zfp438em1(IMPC)J page
IMPC: Zfp438 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTGTCAGGTCCTTGCATACC and GGTGAATCAAACATCCGTTC, which resulted in a 1756 bp deletion beginning at Chromosome 18 position 5,213,148 bp and ending after 5,214,903 bp (GRCm38/mm10). This mutation deletes 1756 bp of (ENSMUSE00000343297) (exon 4) and is predicted to cause a change of amino acid sequence after residue 18 and early truncation 21 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zfp438 Mutation:  36 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory