About   Help   FAQ
Klf16em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Klf16em1(IMPC)J
Name: Kruppel-like transcription factor 16; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6198606
Gene: Klf16  Location: Chr10:80402955-80413130 bp, - strand  Genetic Position: Chr10, 39.72 cM
Alliance: Klf16em1(IMPC)J page
IMPC: Klf16 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTCATGCGGTCTATGGATA and CGCACCTCAAGTCACACCTG, which resulted in a 444 bp deletion beginning at Chromosome 10 position 80,576,763 bp and ending after 80,577,206 bp (GRCm38/mm10). This mutation deletes 444 bp from (ENSMUSE00000307925) (exon 1)including the Kozak sequence and ATG start and leaving the final 16 bp of exon 1 and splice donor. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Klf16 Mutation:  20 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory