About   Help   FAQ
Shox2em1Lap
Endonuclease-mediated Allele Detail
Summary
Symbol: Shox2em1Lap
Name: SHOX homeobox 2; endonuclease-mediated mutation 1, Len A Pennacchio
MGI ID: MGI:6198296
Synonyms: Shox2delta
Gene: Shox2  Location: Chr3:66879060-66889104 bp, - strand  Genetic Position: Chr3, 30.76 cM, cytoband E3-F1
Alliance: Shox2em1Lap page
Mutation
origin
Strain of Origin:  FVB
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsCRISPR-targeting using two sgRNAs (targeting CGAGTCCATCGCCGCAGCTGTGG and GGGGTTCACTAGGAGTTGCGAGG) deleted exons 1-5. (J:261810)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Shox2 Mutation:  21 strains or lines available
References
Original:  J:261810 Osterwalder M, et al., Enhancer redundancy provides phenotypic robustness in mammalian development. Nature. 2018 Feb 8;554(7691):239-243
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory