About   Help   FAQ
Gli3em1Lap
Endonuclease-mediated Allele Detail
Summary
Symbol: Gli3em1Lap
Name: GLI-Kruppel family member GLI3; endonuclease-mediated mutation 1, Len A Pennacchio
MGI ID: MGI:6197986
Synonyms: Gli3delta
Gene: Gli3  Location: Chr13:15638308-15904611 bp, + strand  Genetic Position: Chr13, 5.43 cM, cytoband A2
Alliance: Gli3em1Lap page
Mutation
origin
Strain of Origin:  FVB
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsCRISPR-targeting using two sgRNAs (targeting CGTCTTGAAGGCAGAGTGGGTGG and AGAGCATTGGGCATGGCTGGGGG) deleted exon 1. (J:261810)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Gli3 Mutation:  84 strains or lines available
References
Original:  J:261810 Osterwalder M, et al., Enhancer redundancy provides phenotypic robustness in mammalian development. Nature. 2018 Feb 8;554(7691):239-243
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory