Gli3^em1Lap
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gli3^em1Lap
• Name: GLI-Kruppel family member GLI3; endonuclease-mediated mutation 1, Len A Pennacchio
• MGI ID: MGI:6197986
• Synonyms: Gli3^delta
• Gene: Gli3 Location: Chr13:15638308-15904611 bp, + strand Genetic Position: Chr13, 5.43 cM, cytoband A2
• Alliance: Gli3^em1Lap page

Mutation origin

• Strain of Origin: FVB

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR-targeting using two sgRNAs (targeting CGTCTTGAAGGCAGAGTGGGTGG and AGAGCATTGGGCATGGCTGGGGG) deleted exon 1. (J:261810)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Gli3 Mutation: 80 strains or lines available

References

• Original: J:261810 Osterwalder M, et al., Enhancer redundancy provides phenotypic robustness in mammalian development. Nature. 2018 Feb 8;554(7691):239-243
• All: 1 reference(s)