About   Help   FAQ
Rr61em1Lap
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr61em1Lap
Name: regulatory region 61; endonuclease-mediated mutation 1, Len A Pennacchio
MGI ID: MGI:6197936
Synonyms: hs1262
Gene: Rr61  Location: Chr3:66845656-66847450 bp, . strand  Genetic Position: Chr3, Syntenic
Alliance: Rr61em1Lap page
Mutation
origin
Strain of Origin:  FVB
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intragenic deletion
 
Mutation detailsCRISPR-targeting using two sgRNAs (targeting GATCTCAGATTTGACAAGAGAGG and GCGATGAGGTACAGTAAGAGAGG) removed the ortholog of human enhancer hs1262 located 43 kb downstream of Shox2. (J:261810)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr61 Mutation:  0 strains or lines available
References
Original:  J:261810 Osterwalder M, et al., Enhancer redundancy provides phenotypic robustness in mammalian development. Nature. 2018 Feb 8;554(7691):239-243
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory