About   Help   FAQ
Rr59em1Lap
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr59em1Lap
Name: regulatory region 59; endonuclease-mediated mutation 1, Len A Pennacchio
MGI ID: MGI:6197932
Synonyms: hs1586-
Gene: Rr59  Location: Chr13:15723560-15725418 bp, . strand  Genetic Position: Chr13, Syntenic
Alliance: Rr59em1Lap page
Mutation
origin
Strain of Origin:  FVB
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intragenic deletion
 
Mutation detailsCRISPR-targeting using two sgRNAs (targeting GTTTACCTCAGGCCTGTTTCTGG and GAGGCACTGAGCATGCGCTGGGG) removed the ortholog of human enhancer hs1586 located 86 kb downstream of Gli3. (J:261810)
Expression
In Mice Carrying this Mutation: 1 RNA-Seq or microarray experiment(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr59 Mutation:  0 strains or lines available
References
Original:  J:261810 Osterwalder M, et al., Enhancer redundancy provides phenotypic robustness in mammalian development. Nature. 2018 Feb 8;554(7691):239-243
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/19/2026
MGI 6.24
The Jackson Laboratory