About   Help   FAQ
Rr58em1Lap
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr58em1Lap
Name: regulatory region 58; endonuclease-mediated mutation 1, Len A Pennacchio
MGI ID: MGI:6197930
Synonyms: mm1179-
Gene: Rr58  Location: Chr13:15517292-15518803 bp, . strand  Genetic Position: Chr13, Syntenic
Alliance: Rr58em1Lap page
Mutation
origin
Strain of Origin:  FVB
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intragenic deletion
 
Mutation detailsCRISPR-targeting using two sgRNAs (targeting ATGGGACATGTTGCCATCCGAGG and AGATGGGCACTCGATAACTTAGG) removed the mm1179 enhancer located 120 kb upstream of Gli3. (J:261810)
Expression
In Mice Carrying this Mutation: 1 RNA-Seq or microarray experiment(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr58 Mutation:  0 strains or lines available
References
Original:  J:261810 Osterwalder M, et al., Enhancer redundancy provides phenotypic robustness in mammalian development. Nature. 2018 Feb 8;554(7691):239-243
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory