About   Help   FAQ
Mvdem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Mvdem1(IMPC)J
Name: mevalonate (diphospho) decarboxylase; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6196088
Gene: Mvd  Location: Chr8:123160340-123170161 bp, - strand  Genetic Position: Chr8, 71.05 cM
Alliance: Mvdem1(IMPC)J page
IMPC: Mvd gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences CGGACGTAAAACCAACCCCG, TCACTGCCCAGATACAGCCG, GATGGTCAACGGGAATTAGG and TGAACCTTCCCAGAGCACAG, which resulted in a 428 bp deletion beginning at Chromosome 8 position 122,440,127 bp and ending after 122,440,554 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000215074 (exon 2) and 357 bp of flanking intronic sequence including the splice acceptor and donor. This exon deletion is predicted to cause a change of amino acid sequence after residue 24 and early truncation 9 amino acids later. In addition, there are 2 smaller intronic deletions before the 428 bp deletion, neither of which should alter the results of the exon deletion: a 16 bp deletion (CAACCCCGTGGCTTTG) and a single bp (T) deletion that are 71 bp and 15 bp before the 428 bp deletion, respectively. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Mvd Mutation:  21 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory