About   Help   FAQ
Wdr6em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Wdr6em1(IMPC)J
Name: WD repeat domain 6; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6195848
Gene: Wdr6  Location: Chr9:108449510-108455862 bp, - strand  Genetic Position: Chr9, 59.51 cM, cytoband F2
Alliance: Wdr6em1(IMPC)J page
IMPC: Wdr6 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCAAGGTGGACCCTGAGACC and AGGCGAGGGGCCTGATTTAC, which resulted in a 2,470 bp deletion beginning at Chromosome 9 position 108,574,104 bp and ending after 108,576,573 bp (GRCm38/mm10). This mutation deletes 2,470 bp from ENSMUSE00000240681 (exon 2) and is predicted to cause a change of amino acid sequence after residue 37 and early truncation 31 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Wdr6 Mutation:  43 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/07/2026
MGI 6.24
The Jackson Laboratory