About   Help   FAQ
Cabp2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Cabp2em1(IMPC)J
Name: calcium binding protein 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6195841
Gene: Cabp2  Location: Chr19:4131578-4137340 bp, + strand  Genetic Position: Chr19, 3.79 cM, cytoband A
Alliance: Cabp2em1(IMPC)J page
IMPC: Cabp2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TCAGAAGACTGTGGGAACAG, GTGCGCTGTTCCAAACGCCC, GACACAGAAAGAGGGTGCCG and TTGTTATTAAAGGGAGAGCA, which resulted in a 954 bp deletion beginning at Chromosome 19 position 4,084,827 bp and ending after 4,085,780 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000145610 and ENSMUSE00000145606 (exon 2,3) and 788 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 54 and early truncation 12 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Cabp2 Mutation:  22 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory