About   Help   FAQ
Fam83aem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Fam83aem1(IMPC)J
Name: family with sequence similarity 83, member A; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6195295
Gene: Fam83a  Location: Chr15:57848815-57874405 bp, + strand  Genetic Position: Chr15, 24.17 cM
Alliance: Fam83aem1(IMPC)J page
IMPC: Fam83a gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences GAGGGCGTCACTTACTAACT, GTTTTATCACAATTCCTAAG, TGAGGGCGTCACTTACTAAC and GGGAGCAGCCATCATCCAGC, which resulted in a 222 bp deletion beginning at Chromosome 15 position 57,995,181 bp and ending after 57,995,402 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000867629 (exon 3) and 97 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 216 and early truncation 24 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Fam83a Mutation:  31 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory