Fam83a^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Fam83a^em1(IMPC)J
• Name: family with sequence similarity 83, member A; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6195295
• Gene: Fam83a Location: Chr15:57848815-57874405 bp, + strand Genetic Position: Chr15, 24.17 cM
• Alliance: Fam83a^em1(IMPC)J page
• IMPC: Fam83a gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences GAGGGCGTCACTTACTAACT, GTTTTATCACAATTCCTAAG, TGAGGGCGTCACTTACTAAC and GGGAGCAGCCATCATCCAGC, which resulted in a 222 bp deletion beginning at Chromosome 15 position 57,995,181 bp and ending after 57,995,402 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000867629 (exon 3) and 97 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 216 and early truncation 24 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Fam83a Mutation: 31 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)