About   Help   FAQ
Piezo2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Piezo2em1(IMPC)J
Name: piezo-type mechanosensitive ion channel component 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6195008
Gene: Piezo2  Location: Chr18:63143284-63520254 bp, - strand  Genetic Position: Chr18, 35.95 cM, cytoband D3
Alliance: Piezo2em1(IMPC)J page
IMPC: Piezo2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TGGGGCTCATTTCAACCTAA, CCTTGACGTTGGAAAGCCAA, TTACTACACACTAGGTTATG and GCAAACGTCTCCACTCTCCT, which resulted in a 443 bp deletion beginning at Chromosome 18 position 63,030,248 bp and ending after 63,030,690 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001304790 (exon 42) and 190 bp of flanking intronic sequence including the splice acceptor and donor. At the deletion site there is a 126 bp insertion (AGAATGGGGACGAGGAGTGTTAGGATATTAATAAAGAACACTATTAGGGAGAGGATTTGAACCTCTGGGAACAAGGTTTTAAGTCTTACGCAATTTCCTGGCTCTGCCACCCTAATAACCTTCTCT) that is from the mouse mitochondrial genome (ChrM 2666-2791). This 126 bp segment contains the coding sequence for mt-Tl1 (tRNA leucine 1). The exon deletion is predicted to cause a change of amino acid sequence after residue 2106 and early truncation 15 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Piezo2 Mutation:  128 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory