Tnrc6cem1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Tnrc6cem1(IMPC)J |
Name: |
trinucleotide repeat containing 6C; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6195001 |
Gene: |
Tnrc6c Location: Chr11:117545115-117654265 bp, + strand Genetic Position: Chr11, 82.96 cM
|
Alliance: |
Tnrc6cem1(IMPC)J page
|
IMPC: |
Tnrc6c gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences CTTATAAACCTTCATCAGTG, ACATGTGCAATTGTGTCCAA, AGCAAACTTCTAAGTATTTT and AGTAGTATCAAACTTTGCAA, which resulted in a 139 bp deletion beginning at Chromosome 11 position 117,702,396 bp and ending after 117,702,534 bp (GRCm38/mm10). This mutation deletes the last 5 bases of ENSMUSE00001287639 (exon 3) and 134 bp of flanking intronic sequence including the splice donor and is predicted to cause a change of amino acid sequence after residue 28 and early truncation 6 amino acids later, by read through into the intron.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|