Tnrc6cem1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Tnrc6cem1(IMPC)J |
| Name: |
trinucleotide repeat containing 6c; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6195001 |
| Gene: |
Tnrc6c Location: Chr11:117545115-117654265 bp, + strand Genetic Position: Chr11, 82.96 cM
|
| Alliance: |
Tnrc6cem1(IMPC)J page
|
| IMPC: |
Tnrc6c gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences CTTATAAACCTTCATCAGTG, ACATGTGCAATTGTGTCCAA, AGCAAACTTCTAAGTATTTT and AGTAGTATCAAACTTTGCAA, which resulted in a 139 bp deletion beginning at Chromosome 11 position 117,702,396 bp and ending after 117,702,534 bp (GRCm38/mm10). This mutation deletes the last 5 bases of ENSMUSE00001287639 (exon 3) and 134 bp of flanking intronic sequence including the splice donor and is predicted to cause a change of amino acid sequence after residue 28 and early truncation 6 amino acids later, by read through into the intron.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|