Dhx58^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dhx58^em1(IMPC)J
• Name: DExH-box helicase 58; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6194877
• Gene: Dhx58 Location: Chr11:100585710-100595097 bp, - strand Genetic Position: Chr11, 63.52 cM
• Alliance: Dhx58^em1(IMPC)J page
• IMPC: Dhx58 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences GTATATTTGGTAGGACTGGG, AGCAGGTAGGAATGAAAGCG, AGACAAGCAAAGATCTATGG and GAAAGCCGTGACCTGCTCAC, which resulted in a 442 bp deletion beginning at Chromosome 11 position 100,703,029 bp and ending after 100,703,470 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001306256 (exon 4) and 251 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 123 and early truncation 23 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Dhx58 Mutation: 36 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)