About   Help   FAQ
Dusp23em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Dusp23em1(IMPC)J
Name: dual specificity phosphatase 23; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6194214
Gene: Dusp23  Location: Chr1:172458336-172460504 bp, - strand  Genetic Position: Chr1, 80.05 cM, cytoband H3
Alliance: Dusp23em1(IMPC)J page
IMPC: Dusp23 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CGAGGCCAATGCCCGGGGAG and GGAAGCACCCAGGAGAAGTT, which resulted in a 263 bp deletion beginning at Chromosome 1 position 172,632,616 bp and ending after 172,632,878 bp (GRCm38/mm10). This mutation creates an internal deletion of 263 bp in ENSMUSE00000160363 (exon 1) resulting in a frame shift that is predicted to cause a change of amino acid sequence after residue 2 and early truncation 33 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Dusp23 Mutation:  10 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory