About   Help   FAQ
Zc3h13em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zc3h13em1(IMPC)J
Name: zinc finger CCCH type containing 13; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6189585
Gene: Zc3h13  Location: Chr14:75521813-75581866 bp, + strand  Genetic Position: Chr14, 39.8 cM, cytoband D2
Alliance: Zc3h13em1(IMPC)J page
IMPC: Zc3h13 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences CCAATAATAATAACACCATA, GTCAGGTAGGGGCTCTTTAA, AGAGAGTAGTTCCTGGAATG and CACCTGGGGCTGTGTCAGGT, which resulted in a 563 bp deletion beginning at Chromosome 14 position 75,291,999 bp and ending after 75,292,561 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000122846 (exon 3) and 453 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 39 and early truncation 7 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zc3h13 Mutation:  65 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/14/2026
MGI 6.24
The Jackson Laboratory