Wdr90em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Wdr90em1(IMPC)J |
| Name: |
WD repeat domain 90; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6189578 |
| Gene: |
Wdr90 Location: Chr17:26063745-26080475 bp, - strand Genetic Position: Chr17, 12.94 cM
|
| Alliance: |
Wdr90em1(IMPC)J page
|
| IMPC: |
Wdr90 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences GTAAGGTCTGCTGGGCTAAA, TTACGATTCTAGGACCTCAG, GGTGGGACGAGTGAGTTTTA and CTGGAAATAGGCCCAGAGAA, which resulted in a 1250 bp deletion beginning at Chromosome 17 position 25,858,456 bp for 1187 bp followed by an endogenous 4 bp retention (TCTG) then an additional 63 bp deletion ending after 25,859,709 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001267257, ENSMUSE00001247912, ENSMUSE00001253441 (exons 7-9) and 858 bp of flanking intronic sequence including the splice acceptor and donor. Eighteen bp before the exon deletions there is an 11 bp deletion that will not alter the results of the exon deletions. Overall, the exon deletions are predicted to cause a change of amino acid sequence after residue 323 and early truncation 23 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
2 reference(s) |
|