About   Help   FAQ
Wdr90em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Wdr90em1(IMPC)J
Name: WD repeat domain 90; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6189578
Gene: Wdr90  Location: Chr17:26063745-26080475 bp, - strand  Genetic Position: Chr17, 12.94 cM
Alliance: Wdr90em1(IMPC)J page
IMPC: Wdr90 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences GTAAGGTCTGCTGGGCTAAA, TTACGATTCTAGGACCTCAG, GGTGGGACGAGTGAGTTTTA and CTGGAAATAGGCCCAGAGAA, which resulted in a 1250 bp deletion beginning at Chromosome 17 position 25,858,456 bp for 1187 bp followed by an endogenous 4 bp retention (TCTG) then an additional 63 bp deletion ending after 25,859,709 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001267257, ENSMUSE00001247912, ENSMUSE00001253441 (exons 7-9) and 858 bp of flanking intronic sequence including the splice acceptor and donor. Eighteen bp before the exon deletions there is an 11 bp deletion that will not alter the results of the exon deletions. Overall, the exon deletions are predicted to cause a change of amino acid sequence after residue 323 and early truncation 23 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Wdr90 Mutation:  72 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory