About   Help   FAQ
Hspd1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Hspd1em1(IMPC)J
Name: heat shock protein 1 (chaperonin); endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6188980
Gene: Hspd1  Location: Chr1:55116994-55127402 bp, - strand  Genetic Position: Chr1, 28.01 cM
Alliance: Hspd1em1(IMPC)J page
IMPC: Hspd1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences CTACAACGAATGTAATAAAA, GGTGGCATCTGTTAGTACCA, AAGACAACAGAATTCTTTAC and TTGAGATTCATGTTGCAGGA, which resulted in a 469 bp deletion beginning at Chromosome 1 position 55,084,501 bp and ending after 55,084,969 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001374725 (exon 3) and 216 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a single bp insertion (G) at the deletion site as well as an indel with a 5 bp insert (GTCTC) and 4 bp deletion (TTAT) 29 bp after the 469 bp deletion that will not alter the results of the deletion. This deletion is predicted to cause a change of amino acid sequence after residue 58 and early truncation 1 amino acid later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Hspd1 Mutation:  46 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory