Mical3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mical3^em1(IMPC)J
• Name: microtubule associated monooxygenase, calponin and LIM domain containing 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6188966
• Gene: Mical3 Location: Chr6:120908668-121107959 bp, - strand Genetic Position: Chr6, 57.03 cM
• Alliance: Mical3^em1(IMPC)J page
• IMPC: Mical3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences AGAAGGCAGGTTATAGACCA, GCTTGAGGTAGACATGCCAG, TTTTGTACAAGAGCCCCACT and AGATCGGCAAAACTTAAATG, which resulted in a 641 bp deletion beginning at Chromosome 6 position 121,040,118 bp and ending after 121,040,758 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001050613 (exon 3) and 443 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a 4 bp insertion (GATC) and a 5 bp deletion (TTTAA) 59 bp before the start of the exon deletion, that will not alter the results of the deletion, which is predicted to cause a change of amino acid sequence after residue 88 and early truncation 6 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Mical3 Mutation: 83 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)