Coro2bem1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Coro2bem1(IMPC)J |
Name: |
coronin, actin binding protein, 2B; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6188963 |
Gene: |
Coro2b Location: Chr9:62326774-62444326 bp, - strand Genetic Position: Chr9, 33.71 cM
|
Alliance: |
Coro2bem1(IMPC)J page
|
IMPC: |
Coro2b gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences GCCACAGTCAGCAGGCAGAT, AGAGAAGCAACGAGAGTAGA, GGACCCACACGTGCCACCTT and TGGTAGCTCTACTAGGGGCA, which resulted in a 358 bp deletion beginning at Chromosome 9 position 62,427,786 bp and ending after 62,428,143 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001375364 (exon 8) and 261 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 290 and early truncation 21 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|