Sec62^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Sec62^em1(IMPC)J
• Name: SEC62 homolog, preprotein translocation; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6188014
• Gene: Sec62 Location: Chr3:30847025-30875412 bp, + strand Genetic Position: Chr3, 14.29 cM, cytoband A3
• Alliance: Sec62^em1(IMPC)J page
• IMPC: Sec62 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences AGCATTTTCATTACCGTTGA, CTAATTGTTATCCTTCACCA, GTTGATTATTCAGAGATTGA and TATTTACCAGAGCTACTGAA, which resulted in a 537 bp deletion beginning at Chromosome 3 position 30,800,839 bp and ending after 30,801,375 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000172459 (exon 3) and 431 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 48 and early truncation 2 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Sec62 Mutation: 30 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)