Psmd13^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Psmd13^em1(IMPC)J
• Name: proteasome (prosome, macropain) 26S subunit, non-ATPase, 13; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6188002
• Gene: Psmd13 Location: Chr7:140462307-140478555 bp, + strand Genetic Position: Chr7, 86.09 cM, cytoband F5
• Alliance: Psmd13^em1(IMPC)J page
• IMPC: Psmd13 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by microinjecting Cas9 mRNA and 2 guide sequences TTTAACTCCTGGCTGTGCAG and TCAACATCGTCTGAGCTGTC, which resulted in a 208 bp deletion beginning at Chromosome 7 position 140,883,394 bp and ending after 140,883,601 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001295831 (exon 2) and 129 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 31 and early truncation 13 amino acids later. (J:188991, J:384794)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Psmd13 Mutation: 26 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)