About   Help   FAQ
Psmd6em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Psmd6em1(IMPC)J
Name: proteasome (prosome, macropain) 26S subunit, non-ATPase, 6; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6187994
Gene: Psmd6  Location: Chr14:8348818-8357578 bp, + strand  Genetic Position: Chr14, 7.08 cM
Alliance: Psmd6em1(IMPC)J page
IMPC: Psmd6 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TTTGCACTGATGTACAACAT, GCTAAGATCGGCTCTCAAGC, AGCACCTCTCATCTGCAGAG and TGATCGCGACTAAGGCCAAG, which resulted in a 548 bp deletion beginning at Chromosome 14 position 14,119,831 bp and ending after 14,120,378 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000120407 (exon 2) and 342 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a single bp (G) insertion at the deletion site that will not alter the results of the exon deletion and is predicted to cause a change of amino acid sequence after residue 48 and early truncation 12 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Psmd6 Mutation:  23 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory