About   Help   FAQ
Ripk3em1Kiwa
Endonuclease-mediated Allele Detail
Summary
Symbol: Ripk3em1Kiwa
Name: receptor-interacting serine-threonine kinase 3; endonuclease-mediated mutation 1, Kazuhiro Iwai
MGI ID: MGI:6187931
Synonyms: mRIP3-1
Gene: Ripk3  Location: Chr14:56022452-56026314 bp, - strand  Genetic Position: Chr14, 28.19 cM, cytoband C1
Alliance: Ripk3em1Kiwa page
Mutation
origin
Strain of Origin:  Not Specified
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsA 7 bp deletion (GCCCTCG) was created in exon 3 using sgRNAs (targeting AACCCGAGTGCCCTCGGCCC and AGGTCCCGGTGCAGGAGCGG) with CRISPR/Cas9 technology, leading to a frameshift and premature stop codon (p.R49Gfs*2). This mutation was created in oocytes containing the Rnf31tm1.1Kiwa allele. These two genes are tightly linked on chromosome 14. (J:261488)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ripk3 Mutation:  34 strains or lines available
References
Original:  J:261488 Sasaki Y, et al., Crucial Role of Linear Ubiquitin Chain Assembly Complex-Mediated Inhibition of Programmed Cell Death in TLR4-Mediated B Cell Responses and B1b Cell Development. J Immunol. 2018 May 15;200(10):3438-3449
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory