Ripk3^em1Kiwa
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ripk3^em1Kiwa
• Name: receptor-interacting serine-threonine kinase 3; endonuclease-mediated mutation 1, Kazuhiro Iwai
• MGI ID: MGI:6187931
• Synonyms: mRIP3-1
• Gene: Ripk3 Location: Chr14:56022452-56026314 bp, - strand Genetic Position: Chr14, 28.19 cM, cytoband C1
• Alliance: Ripk3^em1Kiwa page

Mutation origin

• Strain of Origin: Not Specified

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: A 7 bp deletion (GCCCTCG) was created in exon 3 using sgRNAs (targeting AACCCGAGTGCCCTCGGCCC and AGGTCCCGGTGCAGGAGCGG) with CRISPR/Cas9 technology, leading to a frameshift and premature stop codon (p.R49Gfs*2). This mutation was created in oocytes containing the Rnf31^tm1.1Kiwa allele. These two genes are tightly linked on chromosome 14. (J:261488)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ripk3 Mutation: 34 strains or lines available

References

• Original: J:261488 Sasaki Y, et al., Crucial Role of Linear Ubiquitin Chain Assembly Complex-Mediated Inhibition of Programmed Cell Death in TLR4-Mediated B Cell Responses and B1b Cell Development. J Immunol. 2018 May 15;200(10):3438-3449
• All: 1 reference(s)