Appbp2em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Appbp2em1(IMPC)J |
Name: |
amyloid beta precursor protein binding protein 2; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6164048 |
Gene: |
Appbp2 Location: Chr11:85082134-85125946 bp, - strand Genetic Position: Chr11, 51.34 cM, cytoband B5
|
Alliance: |
Appbp2em1(IMPC)J page
|
IMPC: |
Appbp2 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTGGTGGTGGATATTTTGG and ACAACTCTCGCTGCCGGGCG, which resulted in a 237 bp deletion beginning at Chromosome 11 position 85,216,273 bp and ending after 85,216,509 bp (GRCm38/mm10). This mutation deletes all but the first 15 bp of ENSMUSE00000105717 (exon 2) and 163 bp of flanking intronic sequence including the splice donor and is predicted to cause a change of amino acid sequence after residue 51 and early truncation 15 amino acids later due to read through into the intron between exons 2 and 3.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|