Appbp2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Appbp2^em1(IMPC)J
• Name: amyloid beta precursor protein binding protein 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6164048
• Gene: Appbp2 Location: Chr11:85082134-85125946 bp, - strand Genetic Position: Chr11, 51.34 cM, cytoband B5
• Alliance: Appbp2^em1(IMPC)J page
• IMPC: Appbp2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTGGTGGTGGATATTTTGG and ACAACTCTCGCTGCCGGGCG, which resulted in a 237 bp deletion beginning at Chromosome 11 position 85,216,273 bp and ending after 85,216,509 bp (GRCm38/mm10). This mutation deletes all but the first 15 bp of ENSMUSE00000105717 (exon 2) and 163 bp of flanking intronic sequence including the splice donor and is predicted to cause a change of amino acid sequence after residue 51 and early truncation 15 amino acids later due to read through into the intron between exons 2 and 3. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Appbp2 Mutation: 31 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)