Rigiem1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Rigiem1(IMPC)J |
| Name: |
RNA sensor RIG-I; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6164046 |
| Gene: |
Rigi Location: Chr4:40203773-40239828 bp, - strand Genetic Position: Chr4, 20.24 cM
|
| Alliance: |
Rigiem1(IMPC)J page
|
| IMPC: |
Rigi gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TATGGGTTTCAATTATCCTT, TTAGAGGTGACCACACCCTG, CAAACAGTGCAACAATTAAA and GGGAATCCTGTTCAAATCAG, which resulted in a total of 688 bp deletion beginning at Chromosome 4 position 40,229,215 bp for 523 bp followed by a 4 bp endogenous retention (TCTA) then a further 165 bp deletion ending after 40,229,902 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001299001 (exon 3) and 506 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 80 and early truncation 4 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
12 reference(s) |
|