Thsd4em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Thsd4em1(IMPC)J |
Name: |
thrombospondin, type I, domain containing 4; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6164038 |
Gene: |
Thsd4 Location: Chr9:59874214-60429329 bp, - strand Genetic Position: Chr9, 32.38 cM
|
Alliance: |
Thsd4em1(IMPC)J page
|
IMPC: |
Thsd4 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTACCTTGATTCTGCAGAAT and ACTGGACCCATGTGGACACA, which resulted in a 516 bp deletion beginning at Chromosome 9 position 60,428,091 bp and ending after 60,428,606 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000636311 (exon 4) and 154 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 34 and early truncation 52 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|